Monday, September 10, 2012

Illumina Adapter Sequence


Illumina Sequencing에서 사용되는
Adapter중 TruSeq (분석할때 받는 데이터들이 다 요녀석으로 되어 있어서...) DNA/RNA Adapter Sequence를 확인해서 확인해봤습니다. ㅎㅎ


Type
Sequence
TruSeq Universal Adapter
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
TruSeq Adapter, Index 1
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 2
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 3
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 4
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 5
GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 6
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 7
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 8
GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 9
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 10
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 11
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 12
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG


나중에 급할때 찾기 좀 애매해서...
요기다가 급 정리 ㅎㅎ

데이터 받았는데 TruSeq DNA/RNA Adapter인데 Index 12번보다 큰 경우
TruSeq Small RNA Index를 사용하는 것이라고 하네요
기본적인 Adapter sequence는 TruSeq DNA/RNA 인데 Index만 TruSeq Small RNA..
모 그렇다고 합니다. :)

좀더 자세한 Illumina Adapter Sequence에 대해서 알고 싶다면
다음 링크 참조 LINK

No comments: